Ab00347-1.7 Anti-ssDNA/dsDNA [m3D8]
Description: Recombinant monoclonal antibody to ssDNA/dsDNA. Manufactured using AbAb’s Recombinant Platform with variable regions (i.e. specificity) from the hybridoma m3D8. This antibody is in our proprietary AbFab2™ recombinant F(ab'2) format - based on Mouse IgG1 sequence with a short dimerization domain to improve stability and a his tag.
Species and Isotype: Mouse F(ab)2, AbFab2™ His-Tagged, kappa
Clone Number: m3D8
UniProt Accession Number of Target Protein:
Alternative Name(s) of Target: DNA, desoxyribonucleic acid, dsDNA, ssDNA
Published Application(s): ELISA; hyrdolysis; SPR
Published Species Reactivity:
Immunogen: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Specificity: Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes: This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Antibody First Published in:
Kim et al. 2006 Heavy and light chain variable single domains of an anti-DNA binding antibody hydrolyze both double- and single-stranded DNAs without sequence specificity. Journal of Biological Chemistry 2006; 281(22):15287-1595 PMID:16551636 Note on publication: Describes binding studies on mAB 3D8 on different types of oligos (ssDNA, dsDNA, dT:dA, dN:dN etc) using ELISA and SPR.
Concentration: See vial label.
Species and Isotype: Mouse F(ab)2, AbFab2™ His-Tagged, kappa
Clone Number: m3D8
UniProt Accession Number of Target Protein:
Alternative Name(s) of Target: DNA, desoxyribonucleic acid, dsDNA, ssDNA
Published Application(s): ELISA; hyrdolysis; SPR
Published Species Reactivity:
Immunogen: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Specificity: Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes: This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Antibody First Published in:
Kim et al. 2006 Heavy and light chain variable single domains of an anti-DNA binding antibody hydrolyze both double- and single-stranded DNAs without sequence specificity. Journal of Biological Chemistry 2006; 281(22):15287-1595 PMID:16551636 Note on publication: Describes binding studies on mAB 3D8 on different types of oligos (ssDNA, dsDNA, dT:dA, dN:dN etc) using ELISA and SPR.
Product Form
Purification: Purified by Immobilized Metal Affinity Chromatography Supplied in: Bulk size: PBS only. Standard size: PBS with 0.02% Proclin 300.
Storage Recommendation: Store at 4°C for up to 3 months. For longer term storage aliquot into small volumes and store at -20°CConcentration: See vial label.
Important note – This product is for research use only. It is not intended for use in therapeutic or diagnostic
procedures for humans or animals.
1687