Anti-ssDNA/dsDNA [m3D8] Bulk size

Description: Recombinant monoclonal antibody to ssDNA/dsDNA. Manufactured using AbAb’s Recombinant Platform with variable regions (i.e. specificity) from the hybridoma m3D8.
Isotype and Format: Mouse IgG1, kappa
Clone Number: m3D8
Published Application(s): ELISA; hyrdolysis; SPR
Published Species Reactivity:
Immunogen: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Specificity: Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes: This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Antibody First Published in:
Kim et al. 2006 Journal of Biological Chemistry 2006; 281(22):15287-1595 PMID:16551636 Note on publication: Describes binding studies on mAB 3D8 on different types of oligos (ssDNA, dsDNA, dT:dA, dN:dN etc) using ELISA and SPR.

Product Form

This is a Bulk size product. Purified antibody in bulk size.
Purification: Protein A affinity purified
Supplied in: PBS only.
Storage Recommendation: Store at 4°C for up to 3 months. Note, this antibody is provided without added preservatives, it is therefore recommed this antibody be handled under sterile conditions. For longer storage, aliquot and store at -20°C.
Concentration: See vial label

Product Code: Ab00347-1.1-BT

Mouse IgG1

In stock
Standard size 200 µg
Custom conjugation:
Clear selection